Skip to main content

Advertisement

Table 1 List of Drosophila miRNAs and additional unverified candidates supported by third-species conservation

From: Computational identification of DrosophilamicroRNA genes

Reference set miRNAs
Rank Score miR name miR position Cytological position Sequence Ano Apis Other Nearest gene Comment
2 26.15 miR-2a-2 (1) 2L:19547562 37E UAUCACAGCCAAGCUUUGAUGAGC - -   In the intron of spi (sense) [10]; 3 miR cluster
3 26.00 miR-2a-1 (2) 2L:19547974 37E UAUCACAGCCAGCUUUGAUGAGC + + Worm In the intron of spi (sense) [10]; 3 miR cluster
6 24.16 miR-2b-2 (3) 2L:19548259 37E UAUCACAGCCAGCUUUGAGGAGC + +   In the intron of spi (sense) [10]; 3 miR cluster
(8) 24.01* miR-2b-1 2L:8250840 28B UAUCACAGCCAGCUUUGAGGAGC - -   895 upstream of Btk29A [10]; failed conservation filter
8 23.52 miR-13b-2 (4) X:8830202 8C UAUCACAGCCAUUUUGACGAGU - -   In the intron of CG7033 (sense) [10]
9 23.45 miR6-3 (5) 2R:14724424 56E UAUCACAGUGGCUGUUCUUUUU - -   1732 upstream of CG11018 [10]; 7 miR cluster
12 22.89 miR-12 (6) X:15240478 13D UGAGUAUUACAUCAGGUACUGGU + +   1986 upstream of Ac13E [10]; 2 miR cluster
13 22.84 miR-7 (7) 2R:15669777 57A UGGAAGACUAGUGAUUUUGUUGU + + Vertebrate 816 upstream of CG30147 [10]
17 22.45 miR-14 (8) 2R:4614375 45E UCAGUCUUUUUCUCUCUCCUA + +   5855 upstream of Or45b [10]
27 20.94 miR-9 (9) 3L:19515075 76C UCUUUGGUUAUCUAGCUGUAUGA + +   6462 upstream of Shal [10]
29 20.77 miR6-2 (10) 2R:14724582 56E UAUCACAGUGGCUGUUCUUUUU - -   1574 upstream of CG11018 [10]; 7 miR cluster
31 20.65 miR6-1 (11) 2R:14724711 56E UAUCACAGUGGCUGUUCUUUUU - -   1445 upstream of CG11018 [10]; 7 miR cluster
33 20.38 miR-13a (12) 3R:11243269 88F UAUCACAGCCAUUUUGAUGAGU + +   4626 upstream of CG6118 [10]; 3 miR cluster
36 20.08 miR-5 (13) 2R:14724858 56E AAAGGAACGAUCGUUGUGAUAUG - -   1298 upstream of CG11018 [10]; 7 miR cluster
62 18.86 let-7 (14) 2L:18450101 36E UGAGGUAGUAGGUUGUAUAGU + + Vertebrate/ worm 932 upstream of CG10283 [9]; 3 miR cluster
  18.45* miR-10 3R:2635277 84B ACCCUGUAGAUCCGAAUUUGU + + Vertebrate 13566 upstream of Scr [10]; (not on aligned contig)
74 18.42 miR-1 (15) 2L:20457182 38D UGGAAUGUAAAGAAGUAUGGAG + - Vertebrate/ worm 14444 upstream of CG15476 [10]
96 17.79 miR-3 (16) 2R:14725313 56E UCACUGGGCAAAGUGUGUCUCA - -   843 upstream of CG11018 [10]; 7 miR cluster
114 17.49 miR-11 (17) 3R:17439181 93E CAUCACAGUCUGAGUUCUUGC - -   In the intron of E2f (sense) [10]
124 17.36 miR-4 (18) 2R:14724998 56E AUAAAGCUAGACAACCAUUGA - -   1158 upstream of CG11018 [10]; 7 miR cluster
172 16.54 miR-13b-1 (19) 3R:11243135 88F UAUCACAGCCAUUUUGACGAGU + +   4760 upstream of CG6118 [10]; 3 miR cluster
192 16.27 miR-8 (20) 2R:11895154 53D UAAUACUGUCAGGUAAAGAUGUC + +   3783 downstream of CG6301 [10]
  14.20 miR-125 2L:18450405 36E UCCCUGAGACCCUAACUUGUGA + + Vertebrate/ worm 628 upstream of CG10283 [29]: low score; 3 miR cluster
   miR-2c 3R:11243493 88F UAUCACAGCCAGCUUUGAUGGGC - -   4402 upstream of CG6118 Hom; score n/a; 3 miR cluster
Newly verified miRNAs
Rank Score miR name miR position Cytological position Sequence Anos Apis Other Nearest gene Comment
4 24.67 miR-184 2R:8394117 50A UGGACGGAGAACUGAUAAGGG + + Vertebrate 24406 upstream of CG17048 Expression verified
7 24.15 miR-274 3L:11614451 68C UUUUGUGACCGACACUAACGGGUAAU - -   In the intron of CG32085 (antisense) Expression verified
10 23.10 miR-275 2L:7418027 27F cAGUCAGGUACCUGAAGUAGCGCGCG + +   1070 upstream of CG5261 2miR cluster (+Ano and Apis); expression verified
16 22.57 miR-92a 3R:21461594 96E CAUUGCACUUGUCCCGGCCUG + + Vertebrate 6578 upstream of BcDNA:LD22548 2miR cluster
21 21.72 miR-219 3L:17263886 74A UGAUUGUCCAAACGCAAUUCUUG + + Vertebrate 4955 upstream of CG6485 Expression not seen
25 21.12 miR-276a 3L:10322758 67E CAGCGAGGUAUAGAGUUCCUACG + +   47587 upstream of CG12362 Duplicated, 45 kb apart; expression verified; 1copy in Ano and Apis
28 20.88 miR-277 3R:5925763 85F UGUAAAUGCACUAUCUGGUACGACAU + +   1391 upstream of Fmr1 2 miR cluster; expression verified
30 20.73 miR-278 2R:10720792 52B ggUGGGACUUUCGUCCGUUUGUAA + -   386 upstream of fus Expression verified
34 20.27 miR-133 2L:20586360 38D UUGGUCCCCUUCAACCAGCUGU + + Vertebrate 1059 downstream of CG15475 3 miR cluster; expression verified; [45]
37 20.03 miR-279 3R:25030674 99A UGUGACUAGAUCCACACUCAU + +   1328 upstream of CG31044 Related to miR-286; expression verified
38 19.90 miR-33 3L:19716503 76C AGGUGCAUUGUAGUCGCAUUG - - Vertebrate In the intron of HLH106 (sense)  
39 19.77 miR-280 2R:3358854 44C UGUAUUUACGUUGCAUAUGAAAUGAUA - -   21740 upstream of CG30358 Expression verified
41 19.73 miR-281a 2R:7235078 48E ACUGUCGACGGACAGCUCUCUU - -   356 downstream of SmD3 Duplicated cluster; expression verified; 1 copy in Ano
43 19.64 miR-282 3L:3231652 63C aaucUAGCCUCUACUAGGCUUUGUCUGU + -   7132 upstream of CG14959 Expression verified
44 19.55 miR-283 X:15238971 13D AAAUAUCAGCUGGUAAUUCUGGG + +   3493 upstream of Ac13E 2 miR cluster; expression verified
46 19.52 miR-284 3R:8377257 87C UGAAGUCAGCAACUUGAUUCCAGCAAUUG - -   1128 upstream of CG6989 Expression verified
47 19.47 miR-281b 2R:7234866 48E ACUGUCGACGGAUAGCUCUCUU + -   144 downstream of SmD3 Duplicated cluster; expression verified
49 19.35 miR-34 3R:5926677 85F UGGCAGUGUGGUUAGCUGGUUG + + Vertebrate/ worm 477 upstream of Fmr1 2 miR cluster; expression verified; [45]
50 19.27 miR-263a 2L:11942273 33B aAUGGCACUGGAAGAAUUCACg + + Vertebrate 4764 downstream of CG16964 Expression verified; [34]
59 18.89 miR-124 2L:17544454 36D AUAAGGCACGCGGUGAAUGCCA + + Vertebrate/ worm 10606 downstream of CG7094 2 miR cluster; [45]
66 18.58 miR-79 2L:16676639 36A AUAAAGCUAGAUUACCAAAGC + + Worm 822 upstream of CG31782 3 miR cluster; expression verified; [45]
67 18.57 miR-276b 3L:10277315 67E CAGCGAGGUAUAGAGUUCCUACG - - Vertebrate 7073 downstream of CG6559 Duplicated, 45 kb apart; expression verified; 1copy in Ano and Apis
77 18.36 miR-210 X:17859179 16F UUGUGCGUGUGACAGCGGCUA + + Vertebrate 1193 downstream of CG32553  
83 18.11 miR-285 3L:11903642 68E UAGCACCAUUCGAAAUCAGUGCU - - Vertebrate 1592 upstream of CG7252 Similar to miR-29
  18.08* miR-100 2L:18449518 36E AACCCGUAAAUCCGAACUUGUG + - Vertebrate 1515 upstream of CG10283 Failed conservation filter; 3 miR cluster; expression verified; [45]
91 17.93 miR-92b 3R:21466486 96E AAUUGCACUAGUCCCGGCCU + - Vertebrate 1686 upstream of BcDNA:LD22548 Expression verified; 2 miR cluster; [45]
145 17.12 miR-286 2R:14724858 56E AGUGACUAGACCGAACACUCG + -   1013 upstream of CG11018 Expression verified; 7 miR cluster; related to miR-279
146 17.11 bantam 3L:622845 61C AGUGAGAUCAUUUUGAAAGCUG + - Worm 6301 upstream of CG12030 [44]
208 16.09 miR-289 3L:13578391 70C UAAAUAUUUAAGUGGAGCCUGCGACU - -   In the intron of bru-3 (antisense) Expression verified
  13.73 miR-287 2L:17552694 36D UGUGUUGAAAAUCGUUUGCAC + -   14896 upstream of Oli Very low score;found by proximity to miR-124; expression verified
  13.35 miR-87 2L:9942828 30D UGAGCAAAAUUUCAGGUGUG - - Worm 2009 upstream of CG13126 Hom: very low score
   miR-263b 3L:15666960 72D cuUGGCACUGGGAGAAUUCACa + - Vertebrate 4243 upstream of comm Hom; score n/a
   miR-288 2L:20588106 38D UUUCAUGUCGAUUUCAUUUCAUG + -   2805 downstream of CG15475 Score n/a; found by proximity to miR-133; expression verified
Unverified Ano-conserved candidates
Rank Score miR name miR position Cytological position Sequence Ano Apis Other Nearest gene Comment
1 26.76   2R:4681879 46A CAUCACACCCAGGUUGAGUGAGU + +   In the intron of Mmp2 (antisense) NT
5 24.35   3R:121090 82A AAAUUGACUCUAGUAGGGAGUCC + +   533 downstream of CG9780 NT
14 22.63   X:1545630 2B UGCAGGUUUCGUCGACAACGA + -   732 upstream of CG32806 NT
19 22.13   3L:21585985 79A CGAUUUGUCUUUUUCCGCUUACUG + -   1727 downstream of CG7160 NT
20 21.95   3L:18809845 75E UUUUGAUUGUUGCUCAGAAAGCC + +   3283 upstream of CG6865 No expression seen either strand
23 21.38   3L:8530512 66D GUGAGAUAUGUUUGAUAUUCUUGGUUGUU + +   2374 upstream of CG6638 NT
40 19.75   X:12366993 11B UAUCAUAAGACACACGCGGCUAU + -   in the intron of tomosyn (sense) NT
54 19.06   2R:11128979 52E guUAUUGCUUGAGAAUACACGUAGUU + +   15915 upstream of Dg No expression seen either strand
61 18.86   2L:859210 21D AGUUUGUUCGUUUGGCUCGAGUUAU + -   2208 downstream of CG13949 NT
104 17.64   2L:16676008 36A UCUUUGGUAUUCUAGCUGUAGA + -   1453 upstream of CG31782 No expression seen; miR-79 cluster
117 17.44   3R:21403955 96E UGAUAUUGUCCUGUCACAGCAGUA + -   3265 upstream of CG12250 No expression seen
123 17.36   2L:7418192 27F AUUGUACUUCAUCAGGUGCUCUGGUG + +   905 upstream of CG5261 NT
126 17.31   3R:16621175 92F UUUGUUUUGCAAUUUUCGCUUU + -   In the intron of CG17838 (sense) NT
130 17.24   2L:16676828 36A CUUUGGUGAUUUUAGCUGUAUG + -   633 upstream of CG31782 No expression seen; miR-79 cluster
183 16.39   2R:7223583 48E UCAUCCCCUUGUUGCAAACCUCACGC + -   In the intron of CG8877 (sense) NT
190 16.28   3R:5916861 85F UGGGAUACACCCUGUGCUCGCU + -   17107 upstream of CG5361 NT
195 16.24   2L:243049 21B CAUAAGCGUAUAGCUUUUCCC + +   In the intron of kis (sense) NT
  1. These sequences were identified as high-scoring candidates through miRseeker analysis of drosophilid genomes (except as noted) and are ordered by their rank and score. The first part of the table includes members of the reference set, whose rank within the reference set is given in parentheses after the gene name; thus miR-4 ranked 18th among the reference set and 124th overall. The second part of the table includes miRNAs newly identified in this study. In general, we defined a candidate miRNA sequence on the basis of the bounds of conserved sequence; this is often longer than the presumed 21-22 nucleotide mature product. The third part of the table includes unverified gene predictions supported by conservation in Anopheles and/or Apis. Drosophila-specific predictions without confirming expression data may be viewed on the web [43]. References in the comments are to miRNAs that have been independently identified in previous or concurrent studies. n/a, score not available; NT, expression not tested; Hom, miRNA identified solely by homology to other miRNAs. The following miRs were not identifed by miRseeker: miR-10 was not aligned using the first release of the D. pseudoobscura genome while miR-2b-1 and miR-100 failed the conservation filters. These three received very high miRseeker scores, however, and they have been placed into the list for the sake of comparison, although they are not ranked. Six additional miRNAs scored poorly but are genuine. These include two members of the reference set (miR-125 and miR-2c), two that were identified by homology to miRNAs cloned from other species (miR-87 and miR-263b), and two that were identified as Anopheles-conserved stem-loops located in proximity to other Drosophila miRNAs whose expression was verified by northern analysis (miR-287 and miR-288). Most miRNAs are located in intragenic regions, and there is an apparent bias for intronic miRNAs to be located on the transcribed strand.