Skip to main content

Table 2 Conserved wheat miRNA families homologous to known miRNAs from other plant species

From: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)

miRNA family Name Sequence(5'-3')* Length (nt) Pri-miRNA EST no. Conserved in other plants
      Rice Arabidopsis Maize Sorghum
156/157 TaMIR156a UGACAGAAGAGAGUGAGCAC 20 Not found ++ ++ ++ ++
  TaMIR156k UUGACAGAAGAGAGUGAGCA 20   + + + +
  Ta MIR156m UGACAGAAGAGAGUGAGCCU 20   + + + +
159 TaMIR159a UUUGGAUUGAAGGGAGCUCUG 21 CA731881 ++ + ++ ++
  TaMIR159b UUUGGAUUGAAGGGAGCUCUU 21 CA484819 CA682604 + ++ + +
160 TaMIR160 UGCCUGGCUCCCUGUAUGCCA 21 CJ641547 ++ ++ ++ ++
164 TaMIR164a UGGAGAAGCAGGGUACGUGCA 21 CA704421 ++ ++ ++ ++
165 TaMIR165 UCGGACCAGGCUUCAUCCCC 20 Not found   +   
166 TaMIR166b UCGGACCAGGCUUCAUUCCC 20 Not found ++ ++ ++ ++
  TaMIR166g UCGGACCAGGCUUCAAUCCC 20   ++ ++ ++ ++
167 TaMIR167a UGAAGCUGCCAGCAUGAUCUA 21 CK209908 ++ ++ ++ ++
  TaMIR167g UGAAGCUGCCAGCAUGAUCUG 21 CK209889 ++ ++ ++ ++
  TaMIR167m UGAAGCUGCCAGCAUGAUCUGA 22   + + + +
168 TaMIR168a UCGCUUGGUGCAGAUCGGGAC 21 Not found ++ + ++ ++
  TaMIR168b UCGCUUGGUGCAGAUCGGGAU 21   + + + +
169 TaMIR169a CAGCCAAGGAUGACUUGCCGA 21 BJ225371 ++ ++ ++ ++
  TaMIR169b CAGCCAAGGAUGACUUGCCGG 21   ++ ++ ++ ++
  TaMIR169n ACAGCCAAGGAUGACUUGCCG 21   + + + +
  TaMIR169m UAGCCAAGGAUGACUUGCCUG 21   ++ ++ ++ ++
  TaMIR169o UAGCCAAGGAUGACUUGCCUA 21   ++ ++ ++ ++
170/171 TaMIR171a UGAUUGAGCCGUGCCAAUAUC 21 CD910903 ++ ++ ++ ++
  TaMIR171b UUGAGCCGUGCCAAUAUCACG 21   + ++ + +
  TaMIR171h GUGAGCCGAACCAAUAUCACU 21   ++ + ++ ++
172 TaMIR172a AGAAUCUUGAUGAUGCUGCAU 21 Not found ++ ++ ++ ++
  TaMIR172n GAAUCUUGAUGAUGCUGCAU 20   + + + +
  TaMIR172c UGAAUCUUGAUGAUGCUGCAU 21   + + + +
319 TaMIR319a UUGGACUGAAGGGUGCUCCC 20 Not found ++ + ++ ++
  TaMIR319d UUUGGAUUGAAGGGAGCUCU 20 Not found     
390 TaMIR390 AAGCUCAGGAGGGAUAGCGCC 21 Not found ++ ++   
393 TaMIR393 UCCAAAGGGAUCGCAUUGAUC 21 Not found ++ ++ ++ ++
396 TaMIR396a UUCCACAGCUUUCUUGAACUG 21 Not found ++ ++ ++ ++
397 TaMIR397 UUGAGUGCAGCGUUGAUGAA 20 Not found + +   
399 TaMIR399 UGCCAAAGGAGAAUUGCCC 19 CJ666653 + + + +
408 TaMIR408 CUGCACUGCCUCUUCCCUGGC 22 BE419354 ++ ++ ++  
444 TaMIR444 UUGCUGCCUCAAGCUUGCUGC 21 CK200584 ++    
     CA596074     
     BE405735     
479 TaMIR479 AGUGAUAUUGGUCCGGCUCAUU 22 Not found     
  1. The sequences given in this table represent the longest miRNA sequences identified by cloning and 454 sequencing. *The underlined nucleotides represent the non-conserved nucleotides among wheat and other plant species. The plus symbols indicate: ++, miRNA sequences of wheat were exactly identical to those in other species; +, miRNA sequences of wheat were conserved in other species but have variations in some nucleotide positions.