Skip to main content

Table 1 Novel wheat miRNAs identified by direct cloning

From: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)

Name Sequence Length (nt) EST no.* Unigene EST length Precursor length Start, end Energy kcal mol-1 Expression
TamiR501 UAGUACCGGUUCGUGGCACGAACC 24 CA718024 Ta.23206 168 83 20, 102 -67.20 Not detected
    CD878657 Ta.34663 551 151 92, 242 -82.40  
TamiR502 CACUACAUUAUGGAAUGGAGGGA 23 CA670378 Ta.2228 550 245 216, 460 -94.10 Northern blot
TamiR503 UGGCACGGCGUGAUGCUGAGUCAG 24 BG262612 Ta.14534 474 70 340, 409 -36.3 Not tested
TamiR504 ACAUUCUUAUAUUAUGAGACGGAG 24 CA739366 Ta.28672 427 87 14, 100 -68.6 RT-PCR
TamiR505 AGUAGUGAUCUAAACGCUCUUA 22 BJ323011 Ta.38265 690 87 248, 334 -63.8 RT-PCR
    BJ263967 Ta.2752 464 115 78, 192 -49.9  
    CA694693 Ta.12686 491 88 92, 180 -41.4  
TamiR506 UAGAUACAUCCGUAUCUAGA 20 CK214157 Ta.32635 1,048 126 140, 265 -89.3 RT-PCR
    BE430261 Ta.38727 558 128 292, 420 -69.3  
    BJ267812 Ta.14358 179 129 10, 138 -80.4  
TamiR507 UCCGUGAGACCUGGUCUCAUAGA 23 CK217185 Ta.30511 1,047 181 550, 730 -82.4 Northern blot
    AY747601 - - 218 1, 218 -154.3  
TamiR508 GCAGGACGUGAAGAGCGAGUCC 22 BE417418 Ta.23807 310 115 155, 269 -52.70 RT-PCR
TamiR509 AACCAACGAGACCAACUGCGGCGG 24 CA635339 Ta.2228 583 179 190, 368 -87.8 Northern blot
TamiR510 UCCACUAUGGACUACAUACGGAG 23 AJ603161 Ta.639 429 163 95, 257 -70.1 Not detected
TamiR511 UCCUUCCGUUCGGAAUUAC 19 BE405744 Ta.30840 545 116 260, 375 -42.3 Not tested
TamiR512 UACUACUCCCUCCGUCCGAAA 21 BJ320481 Ta.7082 439 133 90, 222 -86.9 Northern blot
TamiR513 CAGCGAGCCAGCGGAGACCGGCAG 24 BJ260462 Ta.6068 572 298 220, 517 -138.0 Northern blot
TamiR514 CCUCCGUCUCGUAAUGUAAGACG 23 CA676805 Ta.14883 625 113 20, 132 -51.2 Northern blot
TamiR515 UAGUACCGGUUCGUGGCUAACC 22 CA686406 Ta.22812 544 67 333, 399 -43.9 Northern blot
TamiR516 AUAGCAAGGAUUGACAGACUG 21 BJ215780 Ta.25530 608 551 50, 600 -172.9 Not tested
TamiR517 CAUAUACUCCCUCCGUCCGAAA 22 BJ276129 Ta.33730 281 145 50, 194 -76.9 Not tested
TamiR518 CAACAACAACAAGAAGAAGAAGAU 24 BE442798 Ta.8114 588 379 91, 469 -145.1 Not tested
TamiR519 CUGCGACAAGUAAUUCCGAACGGA 24 CA698039 Ta.28713 429 109 72, 180 -60.3 Not tested
    DR092358 Ta.41690 250 109 100, 208 -64.0  
TamiR520 UUGUCGCAGGUAUGGAUGUAUCUA 24 BE591362 Ta.2140 463 106 145, 250 -68.8 Not tested
TamiR521 UAGUACAAAGUUGAGUCAUC 20 BJ237878 Ta.3199 685 123 109, 231 -70.0 Not tested
    BQ172311 Ta.12786 474 89 62, 150 -60.9  
TamiR522 GCUUAGAUGUGACAUCCUUAAAA 23 DR733919 Ta.12590 930 147 300, 446 -32.0 Not tested
TamiR523 AGAGUAACAUACACUAGUAACA 22 BQ903908 Ta.27907 636 207 423, 629 -67.4 Not tested
TamiR524 CAUUAUGGAACGGAAGGAG 19 BJ241591 Ta.9978 328 90 141, 230 -46.5 Not tested
  1. * ESTs belonging to same unigene cluster were not included in this table.