Skip to main content

Advertisement

Table 1 Overview of the TFBSs identified using co-expressed genes

From: Identification of novel regulatory modules in dicotyledonous plants using expression data and comparative genomics

TFBS motif* NCS Known motif Site Functional enrichment targets: GO Biological Process or Molecular Function§
nrCAAnTC (a) 5.77 BJ_CAAT-box TGCAAATCT GO:0008152 metabolism 8.58E-04 (1.2); GO:0003824 catalytic activity 8.91E-05 (1.2)
GTACAwry (b) 5.64    GO:0007275 development 2.89E-02 (1.6); GO:0003824 catalytic activity 2.98E-03 (1.2)
TTCkwwTs 5.79 BOXIINTPATPB ATAGAA  
sGCrGAGA 5.77    GO:0015980 energy derivation by oxidation of organic compounds 4.82E-02 (2.7); GO:0008152 metabolism 1.43E-03 (1.2); GO:0003824 catalytic activity 2.89E-03 (1.1)
kCCACGTn (4) 17.54 AT_G-box; HV_ABRE6; PH_boxII GCCACGTGGA; GCCACGTACA; TCCACGTGGC GO:0015979 photosynthesis 2.48E-04 (4.2); GO:0048316 seed development 2.64E-03 (3.6); GO:0009793 embryonic development (sensu Magnoliophyta) 6.15E-03 (3.5)
yCATTTnT (c) 8.7 GM_Unnamed_6 GCATTTTTATCA GO:0003700 transcription factor activity 2.94E-03 (1.3); GO:0030528 transcription regulator activity 1.64E-02 (1.3); GO:0003677 DNA binding 3.86E-02 (1.2)
ynTTATCC 6.75 SREATMSD; AT_I-box TTATCC; CCTTATCCT  
nGTTGACw (d) 5.31 ZM_O2-site GTTGACGTGA GO:0006952 defense response 2.99E-04 (1.9); GO:0009607 response to biotic stimulus 3.56E-04 (1.7); GO:0016301 kinase activity 7.52E-11 (1.7)
TTTGCnrA 6.13    GO:0016773 phosphotransferase activity, alcohol group as acceptor 1.14E-02 (1.6); GO:0016772 transferase activity, transferring phosphorus-containing groups 2.60E-02 (1.5)
rATyTGGG 5.58    
TrTwTATA 9.35 AT_TATA-box TATATAA GO:0019748 secondary metabolism 2.76E-02 (2.1); GO:0006519 amino acid and derivative metabolism 1.35E-02 (1.8); GO:0003700 transcription factor activity 3.36E-02 (1.3)
ATArwACA (e) 5.79 OS_Unnamed_2 CCATGTCATATT  
nTTCCCGC (5) 27.27 NT_E2Fa TTTCCCGC GO:0006261 DNA-dependent DNA replication 6.48E-04 (6.2); GO:0000067 DNA replication and chromosome cycle 1.06E-07 (5.5); GO:0006260 DNA replication 3.57E-05 (5.1)
TkAGAwnA 8.86 BO_TCA-element3 TCAGAAGAGG GO:0006464 protein modification 4.52E-02 (1.7); GO:0003824 catalytic activity 5.20E-03 (1.1)
AAACCCTA (13) (f) 40.06 TELOBOXATEEF1AA1 AAACCCTAA Ribosome biogenesis and assembly 9.86E-13 (4.4); ribosome biogenesis 5.67E-12 (4.3); pre-mRNA splicing factor activity 3.20E-04 (3.9)
mGnyAAAG (g) 6.38    GO:0003824 catalytic activity 2.93E-02 (1.1)
GAnCnkmG 6.29    GO:0003729 mRNA binding 1.00E-02 (3.1); GO:0003735 structural constituent of ribosome 3.69E-02 (1.7); GO:0006412 protein biosynthesis 3.15E-03 (1.7)
TCnCTCTC 8.98 LE_5UTRPy-richstretch TTTCTCTCTCTCTC GO:0003777 microtubule motor activity 9.90E-03 (2.7); GO:0050789 regulation of biological process 2.27E-03 (1.4); GO:0016772 transferase activity, transferring phosphorus-containing groups 7.89E-03 (1.4)
wmGTCmAm 7.16    GO:0003824 catalytic activity 4.51E-03 (1.1)
ynCAACGG 8.39 CR_MSA-like YCYAACGG YYA GO:0003777 microtubule motor activity 3.17E-03 (3.4); GO:0003774 motor activity 8.55E-03 (2.9)
nmGATyCr 5.66    GO:0006944 membrane fusion 2.32E-02 (4.5); GO:0003735 structural constituent of ribosome 2.77E-03 (1.9); GO:0005198 structural molecule activity 7.11E-04 (1.9)
CGkCGmCn 7.68 OS_GC-motif5 CGGCGCCCT  
AGGCCCAw (9) 21.94 UP1ATMSD GGCCCAWWW GO:0007046 ribosome biogenesis 3.56E-14 (4.3); GO:0042254 ribosome biogenesis and assembly 2.28E-14 (4.3); GO:0003735 structural constituent of ribosome 8.66E-29 (3.3)
AykyATwA 6.09    
CTGnCTCy 6.91    GO:0016301 kinase activity 3.44E-02 (1.3); GO:0003676 nucleic acid binding 3.48E-02 (1.2); GO:0005488 binding 2.60E-03 (1.2)
TsTCGnTT 7.22    GO:0003824 catalytic activity 5.10E-03 (1.1)
TmAsTGAn 7.76 OS_GTCAdirectrepeat TAAGTCATAACTGATGA GO:0016491 oxidoreductase activity 3.85E-03 (1.5); GO:0008152 metabolism 5.74E-03 (1.2); GO:0003824 catalytic activity 5.70E-04 (1.2)
yyACrCGT (2) 6.56 ST_G-box TCACACGTGGC GO:0009605 response to external stimulus 4.80E-02 (1.6); GO:0006950 response to stress 3.42E-02 (1.6)
mATATTTT 5.51 GM_Nodule-site1 GATATATTAATATTTTATTTTATA  
CCAATnCm 5.78 CAATBOX1; HV_ATC-motif CAAT; GCCAATCC GO:0008152 metabolism 2.01E-02 (1.2)
rkTCAwGm 5.42    GO:0003824 catalytic activity 6.17E-05 (1.2)
ssCGCCnA (2) 9.13 E2F1OSPCNA GCGGGAAA GO:0000067 DNA replication and chromosome cycle 4.74E-02 (3.0); GO:0006259 DNA metabolism 2.15E-03 (2.3); GO:0007049 cell cycle 4.29E-02 (2.2)
TTTATGnG 7.1    
TCAwATAA 6.74    
  1. *Numbers in parentheses indicate the number of clusters (containing co-expressed genes) in which the motif was independently identified. The letters in parenthesis refer to the updated TFBS identified using the two-way clustering: (a) GCAAnTCn; (b) GTACmwGy; (c) yCATTTAT; (d) mkTTGACT; (e) ATrrwACA; (f) AAACCCTA; (g) mGnCAAAG. Network-level Conservation score. Residues in bold indicate the matching position between the known motif and the motif found in this study. Known motifs were retrieved from PLACE [26] and PlantCARE [27]. §Only the first three GO categories according to the highest enrichment score are shown. The enrichment score is shown as number in parentheses.